Reverse Primer pCS2+_SlitOR
Version 1

CTCACTAAAGGGAACAAAAGCTG

help Creators and Submitter
Creator
Submitter
Activity

Views: 3159   Downloads: 0

Created: 14th May 2018 at 09:00

Last used: 5th Dec 2022 at 12:38

help Attributions

None

Version History

Version 1 Created 14th May 2018 at 09:00 by Guillaume Audic

No revision comments

Powered by
(v.1.12.2)
Copyright © 2008 - 2022 The University of Manchester and HITS gGmbH