Reverse Primer pCS2+_SlitOR
Version 1

CTCACTAAAGGGAACAAAAGCTG

Help
help Creators and Submitter
Creator
Submitter
Activity

Views: 2808   Downloads: 0

Created: 14th May 2018 at 09:00

Last used: 27th Jun 2022 at 22:29

help Attributions

None

Version History

Version 1 Created 14th May 2018 at 09:00 by Guillaume Audic

No revision comments

Related items

Powered by
(v.1.11.3)
Copyright © 2008 - 2021 The University of Manchester and HITS gGmbH