Data files

27 Data files visible to you, out of a total of 48

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat de séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat séquençage en Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultat du séquençage avec le Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultats du séquençage avec le Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

Résultats suite à l'amplification avec le primer Forward

Creator: Guillaume Audic

Contributor: Guillaume Audic

CGGAGCAAGCTTGATTTAGG

Powered by
Seek new full
(v.1.7.1)
Copyright © 2008 - 2018 The University of Manchester and HITS gGmbH