Data files

Created At
Go
27 Data files visible to you, out of a total of 52

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat de séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat séquençage en Forward

Résultat du séquençage avec le Forward

Résultats du séquençage avec le Forward

Résultats suite à l'amplification avec le primer Forward

CGGAGCAAGCTTGATTTAGG

Powered by
(v.1.10.3)
Copyright © 2008 - 2020 The University of Manchester and HITS gGmbH