Forward Primer pCS2+_SlitOR
Version 1

CGGAGCAAGCTTGATTTAGG

Help
help Contributor and Creators
Activity

Views: 563   Downloads: 0

Created: 14th May 2018 at 08:59

Last updated: 14th May 2018 at 09:01

Last used: 16th Sep 2019 at 20:59

help Attributions

None

Related items

Powered by
Seek new full
(v.1.7.1)
Copyright © 2008 - 2018 The University of Manchester and HITS gGmbH