Data files

What is a Data file?

27 Data files visible to you, out of a total of 72

Reverse Primer pCS2+_SlitOR

DEMETER

CTCACTAAAGGGAACAAAAGCTG

Creator: Guillaume Audic

Submitter: Guillaume Audic

Investigations: Biologie moléculaire

Studies: Analyse des plasmides pCS2+

Assays: PCR sur plasmides pCS2+_ORs, Séquençage

Created: 14th May 2018 at 09:00

Electrophorèse pCS2+_SlitORs

DEMETER

Photo du gel d'électrophorèse Dépôt : 5µl de produit de PCR, 2µl loadding buffer, 5µl H2O Migration 90V pendant 50 minutes

Creators: Guillaume Audic, Gabriela Caballero Vidal

Submitter: Guillaume Audic

Investigations: Biologie moléculaire

Studies: Analyse des plasmides pCS2+

Assays: PCR sur plasmides pCS2+_ORs

Created: 14th May 2018 at 08:38

data transformed

CeSGO project

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: Detection Of QTL and functional genomics study ...

Studies: Detection Of QTL and eQTL with effects on osmor...

Assays: clinical chemistry analysis

Download

Created: 29th Nov 2016 at 14:46, Last updated: 22nd Jan 2018 at 10:22

Data day 2

CeSGO project

Chemical Measuments D2

Creators: Cyril Monjeaud, Yvan Le Bras

Submitter: Cyril Monjeaud

Investigations: Detection Of QTL and functional genomics study ...

Studies: Detection Of QTL and eQTL with effects on osmor...

Assays: clinical chemistry analysis

Download

Created: 14th Oct 2016 at 13:21, Last updated: 22nd Jan 2018 at 10:17

megablast.out

CeSGO project

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: No Investigations

Studies: No Studies

Assays: No Assays

Download

Created: 30th Oct 2017 at 10:50

blast_script.sh

CeSGO project

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: No Investigations

Studies: No Studies

Assays: No Assays

Download

Created: 30th Oct 2017 at 10:48, Last updated: 30th Oct 2017 at 10:48

sequences_COI.fasta

CeSGO project

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: No Investigations

Studies: No Studies

Assays: No Assays

Download

Created: 30th Oct 2017 at 10:46

Danio_rerio_genes_Zv9.fasta

CeSGO project

No description specified

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: No Investigations

Studies: No Studies

Assays: No Assays

Download

Created: 30th Oct 2017 at 10:45

phenotype_profil.txt

FEED-A-GENE

animal phenotype description

Creator: Francois Moreews

Submitter: Francois Moreews

Investigations: 1 hidden item

Studies: 1 hidden item

Assays: assay1.1.1 feed comparison - microarray exp2

Download

Created: 23rd Apr 2017 at 23:53

microarray analysis result

FEED-A-GENE

microarray R analysis result

Creator: Francois Moreews

Submitter: Francois Moreews

Investigations: 1 hidden item

Studies: 1 hidden item

Assays: assay1.1.1 feed comparison - microarray exp2

Download

Created: 23rd Apr 2017 at 23:51

transcriptomics raw data file

FEED-A-GENE

transcriptomics raw data file

Creator: Francois Moreews

Submitter: Francois Moreews

Investigations: 1 hidden item

Studies: 1 hidden item

Assays: assay1.1.1 feed comparison - microarray exp2

Download

Created: 7th Apr 2017 at 09:15, Last updated: 23rd Apr 2017 at 23:48

Workflow image

CeSGO project

Image for this workflow

Creator: Cyril Monjeaud

Submitter: Cyril Monjeaud

Investigations: No Investigations

Studies: No Studies

Assays: No Assays

External Link

Created: 17th Oct 2016 at 09:41, Last updated: 4th Jan 2017 at 09:06

Data files

Filters ×

Filters